| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.083911 |
| Chromosome: | chromosome 6 |
| Location: | 5548814 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285250 | LHCBM6 | (1 of 6) K08912 - light-harvesting complex II chlorophyll a/b binding protein 1 (LHCB1); Light-harvesting Chloropyll a/b binding protein of LHCII type I, chloroplast precursor | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGATCCATGCCGCCGTACGAGGTCACC |
| Internal bar code: | TGTGGAGCTGTGCGGCAACTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 691 |
| LEAP-Seq percent confirming: | 99.0146 |
| LEAP-Seq n confirming: | 4622 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGCGTTCTCAGAGTAGGG |
| Suggested primer 2: | GCATTCAGGCATATGTGGTG |