| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.085840 |
| Chromosome: | chromosome 10 |
| Location: | 3448684 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g444700 | SBE3,SBE2b | (1 of 3) 2.4.1.18 - 1,4-alpha-glucan branching enzyme / Glycogen branching enzyme; Starch Branching Enzyme 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGATCGGGGTAGGGAATGAACGAACCCA |
| Internal bar code: | TAAAGGTTTAGTCTGAAATGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 370 |
| LEAP-Seq percent confirming: | 99.5012 |
| LEAP-Seq n confirming: | 2593 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGCTTCATCACCTCAA |
| Suggested primer 2: | GTGTGTCGCGGTCATGTATC |