| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.086493 |
| Chromosome: | chromosome 6 |
| Location: | 6981898 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g296500 | (1 of 1) PF01753//PF07719 - MYND finger (zf-MYND) // Tetratricopeptide repeat (TPR_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCCCCCCCTAGTTTGGGCTGGTATTTAC |
| Internal bar code: | GATGGTACTACGCTGGATAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 566 |
| LEAP-Seq percent confirming: | 95.8727 |
| LEAP-Seq n confirming: | 1928 |
| LEAP-Seq n nonconfirming: | 83 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAATGAACTAGCCCACCC |
| Suggested primer 2: | GCTCACGTCATTCTCAAGCA |