| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.086848 |
| Chromosome: | chromosome 12 |
| Location: | 2119349 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g509050 | PPL1,PSBP3 | PsbP-like protein of thylakoid lumen; (1 of 1) PTHR31407:SF4 - PSBP-LIKE PROTEIN 1, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGAGGGAGCCTGTGGCTTAGGAGTCGAC |
| Internal bar code: | GATCACAATGCCGTCATTGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 612 |
| LEAP-Seq percent confirming: | 99.0572 |
| LEAP-Seq n confirming: | 1471 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGGTGGTGTGATGCTATG |
| Suggested primer 2: | GCCAAGGGCCACAACTACTA |