| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.087664 |
| Chromosome: | chromosome 9 |
| Location: | 1858754 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g395700 | (1 of 5) PTHR18640//PTHR18640:SF9 - FAMILY NOT NAMED // SODIUM/METABOLITE COTRANSPORTER BASS4, CHLOROPLASTIC-RELATED; Sodium:bile acid symporter | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCCACGCCGCTGGACAGGGTGGTAGGCA |
| Internal bar code: | CTGGGATACACGAGAAGGGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 328 |
| LEAP-Seq percent confirming: | 99.6753 |
| LEAP-Seq n confirming: | 614 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAAGGTTGTGGACGTGGT |
| Suggested primer 2: | TCCACCCAATCCATTCTCTC |