Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.088487 |
Chromosome: | chromosome 16 |
Location: | 3888397 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g690250 | PUS18 | TruB family RNA pseudouridine synthase; (1 of 1) K03177 - tRNA pseudouridine55 synthase [EC:5.4.99.25] (truB, PUS4, TRUB1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACCTTGAACCCCCACCCCACCCCATGTA |
Internal bar code: | ATCTTCAATATTAATCGGGCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 44 |
LEAP-Seq percent confirming: | 99.5748 |
LEAP-Seq n confirming: | 1405 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCCTAGCGAAGCGTATTTT |
Suggested primer 2: | CTGAAGCGTACGTTCTTCCC |