Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.088624 |
Chromosome: | chromosome 17 |
Location: | 3883411 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g728250 | (1 of 1) PF16908//PF16910 - Vacuolar sorting-associated protein 13, N-terminal (VPS13) // Repeating coiled region of VPS13 (VPS13_mid_rpt) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAGTGCCACGCTGGCATGCCGCAGGCGC |
Internal bar code: | GGGCACGAATAGTTCGACAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 567 |
LEAP-Seq percent confirming: | 98.9943 |
LEAP-Seq n confirming: | 2953 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGCAGGAACAGGCTACACA |
Suggested primer 2: | CTGCACTTCCCTCTCAGTCC |