| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.088663 |
| Chromosome: | chromosome 3 |
| Location: | 5237784 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182950 | (1 of 1) K12820 - pre-mRNA-splicing factor ATP-dependent RNA helicase DHX15/PRP43 (DHX15, PRP43) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCCCCATAGCACACTCACAATAGCTGG |
| Internal bar code: | CGTTATTGGATGGCAAGCCATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 943 |
| LEAP-Seq percent confirming: | 99.4043 |
| LEAP-Seq n confirming: | 9345 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTGACCAAAATGACGTG |
| Suggested primer 2: | TGCTTTGTCTCCTGCAAATG |