| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.089463 |
| Chromosome: | chromosome 13 |
| Location: | 2254638 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g578750 | TBA1 | (1 of 1) K00207 - dihydropyrimidine dehydrogenase (NADP+) (DPYD); Translation factor for chloroplast psbA mRNA | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACGTGGCAATGGCACGCACAACACACGT |
| Internal bar code: | AGCCAAGTAATAGGAAAAAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 666 |
| LEAP-Seq percent confirming: | 98.8008 |
| LEAP-Seq n confirming: | 3378 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGCGATGCATTCATGTGT |
| Suggested primer 2: | CAGAAGAAGAGGAACCCGTG |