Insertion junction: LMJ.RY0402.090003_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.090003
Chromosome:chromosome_1
Location:7071017
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g051050 FAP225 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCAGGCCAAGTAGCTCTTGTACTAGCACA
Internal bar code:ATCAATGGGCTTAGGAATTAGT

Confirmation - LEAP-Seq

LEAP-Seq distance:242
LEAP-Seq percent confirming:99.7748
LEAP-Seq n confirming:1329
LEAP-Seq n nonconfirming:3
LEAP-Seq n unique pos:5

Suggested primers for confirmation by PCR

Suggested primer 1:CACAGATTCAGAGGCACGAA
Suggested primer 2:CACGCGACCCACATACATAG