Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.090462 |
Chromosome: | chromosome 2 |
Location: | 1630867 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g085257 | COP4,CHR2,CSOB | Channelrhodopsin 2; (1 of 1) IPR001425//IPR029730 - Archaeal/bacterial/fungal rhodopsin // Archaeal/bacterial/fungal rhodopsin-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCCATGTAAGGGCCCACAGCCGCGCGGC |
Internal bar code: | AAGGTTAGAGCAGGTTATTATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 661 |
LEAP-Seq percent confirming: | 99.5935 |
LEAP-Seq n confirming: | 245 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGCTATGGCTCTGCACGTA |
Suggested primer 2: | TAAGGGGCAGGTTGGTGTAG |