| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.090713 |
| Chromosome: | chromosome 14 |
| Location: | 3736304 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632050 | POB25,RPG1,RPGRIP1 | Retinitis pigmentosa GTPase regulator-interacting protein 1; (1 of 1) PF11618 - First C2 domain of RPGR-interacting protein 1 (C2-C2_1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACTCATGATGCGCGTGTCTGCTGACAA |
| Internal bar code: | ATGGGATACGCCATCAAGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 130 |
| LEAP-Seq percent confirming: | 85.6736 |
| LEAP-Seq n confirming: | 903 |
| LEAP-Seq n nonconfirming: | 151 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCCTGCTGCTACAGCCAT |
| Suggested primer 2: | TGGCGTCCTTTTATACTGGC |