| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.090806 |
| Chromosome: | chromosome 4 |
| Location: | 3790501 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g229550 | SRR15 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 5) 1.4.3.13 - Protein-lysine 6-oxidase / Lysyl oxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTACCATTGAAGCTCTTGCTCCGATTGA |
| Internal bar code: | CTCTGCGTCCGAAGTCACGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 0.252578 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 4739 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | CTTTCATCCACCAAGGCACT |