| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.091298 |
| Chromosome: | chromosome 6 |
| Location: | 155000 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g250250 | ATPVC,ATPVC1 | (1 of 1) K02148 - V-type H+-transporting ATPase subunit C (ATPeV1C, ATP6C); Vacuolar ATP synthase subunit C | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGGCTTTGAGCAATGTGACAAACATGC |
| Internal bar code: | AGCTTCGCACGTTCGTCGGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 782 |
| LEAP-Seq percent confirming: | 96.0666 |
| LEAP-Seq n confirming: | 1270 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATGGCACAGCCTGGTTAC |
| Suggested primer 2: | CAACGACTACTCGCTGGTGA |