| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.092264 |
| Chromosome: | chromosome 3 |
| Location: | 4659191 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g177450 | (1 of 1) IPR003729//IPR022772//IPR024053 - Bifunctional nuclease domain // von Hippel-Lindau disease tumour suppressor, beta/alpha domain // von Hippel-Lindau disease tumour suppressor, beta domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAAAGCTGCACCACACCTAAGCATACCA |
| Internal bar code: | CAGACATCGCACACTGAACCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 564 |
| LEAP-Seq percent confirming: | 70.2381 |
| LEAP-Seq n confirming: | 590 |
| LEAP-Seq n nonconfirming: | 250 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTTCTACTCGCGCATCGT |
| Suggested primer 2: | TACAGTGGTGTTGGATGCGT |