| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.092899 |
| Chromosome: | chromosome 10 |
| Location: | 4805315 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g453900 | CYN71 | (1 of 1) K12736 - peptidylprolyl isomerase domain and WD repeat-containing protein 1 [EC:5.2.1.8] (PPWD1); Cyclophilin 71 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCGGCCCCGTTGGCGTTTGGGGCAACGC |
| Internal bar code: | CGGGACTGGCAGCTGTACCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 560 |
| LEAP-Seq percent confirming: | 98.7633 |
| LEAP-Seq n confirming: | 2875 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGAGGACGGATAAGAAAGC |
| Suggested primer 2: | AGTCCATTCCAAACGCAAAC |