| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.093174 |
| Chromosome: | chromosome 12 |
| Location: | 3451234 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g496350 | SSD2 | Sterol sensing 5-transmembrane protein; (1 of 1) PF02460//PF12349 - Patched family (Patched) // Sterol-sensing domain of SREBP cleavage-activation (Sterol-sensing) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGCAGCTCAGCCCTCCGGCGCCCACAC |
| Internal bar code: | TCAGCTCTTGTTGCGGATCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 425 |
| LEAP-Seq percent confirming: | 76.6909 |
| LEAP-Seq n confirming: | 737 |
| LEAP-Seq n nonconfirming: | 224 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACGCTCCATCTATGGTT |
| Suggested primer 2: | AGTGGTACGGCAAGGTGTTC |