Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.093231 |
Chromosome: | chromosome 4 |
Location: | 3732489 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g229300 | RCA1 | (1 of 4) IPR003959//IPR027417 - ATPase, AAA-type, core // P-loop containing nucleoside triphosphate hydrolase; RuBisCO activase 1, chloroplastic | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGTTGATATACTCTTTAGAGGTTGGCCT |
Internal bar code: | CTGTATTCAGCAAGTTTGCGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1312 |
LEAP-Seq percent confirming: | 98.9455 |
LEAP-Seq n confirming: | 2721 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCTGGAACACAAGTTGGAT |
Suggested primer 2: | TGCTGATCAAGTACGGCAAG |