| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.093717 |
| Chromosome: | chromosome 12 |
| Location: | 5965370 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g534700 | FKB19 | (1 of 1) PTHR10516:SF179 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE FKBP19, CHLOROPLASTIC; peptidyl-prolyl cis-trans isomerase, FKBP-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGATACTGGATTCTTGCGTGCTTTTGCCT |
| Internal bar code: | GTACCGGGGTAAAGGACAATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 283 |
| LEAP-Seq percent confirming: | 98.7427 |
| LEAP-Seq n confirming: | 2042 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACAGTGGCCTCTCAATCC |
| Suggested primer 2: | TGGGGATGGTAGGAACGATA |