| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.095235 |
| Chromosome: | chromosome 12 |
| Location: | 5565383 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g531550 | EIF5B3,EIF5Bd,EIF2B | Eukaryotic translation initiation factor 2, beta subunit; (1 of 1) K03238 - translation initiation factor 2 subunit 2 (EIF2S2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGACGGCACTCACTCGTTCACGTAGCGG |
| Internal bar code: | TGAGGTGAAAGGCGCCGCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 211 |
| LEAP-Seq percent confirming: | 99.3647 |
| LEAP-Seq n confirming: | 782 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCGACATGACCACTTCTGC |
| Suggested primer 2: | TGAGGTCGCGTGTTAGTCAG |