| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.095249 |
| Chromosome: | chromosome 1 |
| Location: | 2705034 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016050 | PRP8 | (1 of 1) K12856 - pre-mRNA-processing factor 8 (PRPF8, PRP8); Splicing factor, component of the U5 snRNP and of the spliceosome | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCACCCCATCCCACAAACAACCCACCAC |
| Internal bar code: | AGGCGACCTCGTCTGTTCTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 632 |
| LEAP-Seq percent confirming: | 99.284 |
| LEAP-Seq n confirming: | 2080 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTCAAGTGCGAGAACAAG |
| Suggested primer 2: | GAGGAGGCAGTGCTCGTAAC |