Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.095973 |
Chromosome: | chromosome 12 |
Location: | 1284969 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g489150 | SHD1 | SH2-domain protein; (1 of 2) IPR000980 - SH2 domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGCATGGCTGGCCGCCGCTATGAGGGAA |
Internal bar code: | GCCGAGGAGACTGCGGCCTAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 313 |
LEAP-Seq percent confirming: | 74.6316 |
LEAP-Seq n confirming: | 4913 |
LEAP-Seq n nonconfirming: | 1670 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAAACCGTGTGTTTGGGCT |
Suggested primer 2: | GCTCTGCACCTCCCTTGTAG |