Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.096097 |
Chromosome: | scaffold 24 |
Location: | 42760 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre24.g755347 | MUT6 | Transgene and transposon silencing 6; (1 of 1) K12815 - pre-mRNA-splicing factor ATP-dependent RNA helicase DHX38/PRP16 (DHX38, PRP16) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCGTAAACTTAATGCATGTAATCCCTC |
Internal bar code: | TGTGGGGCCTGTTGAAACATTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 13 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 140 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAAACTCCAACAGGTCGTT |
Suggested primer 2: | AGAGGGTTGAAGAGGGGTGT |