| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.100318 |
| Chromosome: | chromosome 9 |
| Location: | 552880 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g403800 | ODA4,ROC30,DYHB,DHC14,ODA-DHCbeta,ROC54 | Flagellar outer arm dynein heavy chain beta; (1 of 2) PTHR10676//PTHR10676:SF36 - DYNEIN HEAVY CHAIN FAMILY PROTEIN // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTAGTTATTGGCGGTCTGGCCGCAGCACA |
| Internal bar code: | GATGCATAGCGTGTAGTCGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 454 |
| LEAP-Seq percent confirming: | 98.9799 |
| LEAP-Seq n confirming: | 2911 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTTTGTACGCGTGAGATT |
| Suggested primer 2: | AAGCATACCAGCCCACACTC |