Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.102507 |
Chromosome: | chromosome 10 |
Location: | 1983224 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g432450 | (1 of 29) PF13637 - Ankyrin repeats (many copies) (Ank_4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTCGTGTGGTCCGCGTGGAGCACCATGT |
Internal bar code: | GTCTGGAGTTTTTTTTATGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 633 |
LEAP-Seq percent confirming: | 93.8017 |
LEAP-Seq n confirming: | 454 |
LEAP-Seq n nonconfirming: | 30 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGCGGGTTCTTCGTGGTA |
Suggested primer 2: | AACAAGGACCACGAGGATTG |