| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.104860 |
| Chromosome: | chromosome 6 |
| Location: | 5086061 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280700 | (1 of 2) PF10197 - N-terminal domain of CBF1 interacting co-repressor CIR (Cir_N) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGATGCCGGGCTCCCCGGGGTTAGCAGCC |
| Internal bar code: | CACGGGGATCCTGTTCGCATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 685 |
| LEAP-Seq percent confirming: | 98.9868 |
| LEAP-Seq n confirming: | 1954 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCATTGCTGGTACTCCGTC |
| Suggested primer 2: | CGTTCCTCCTCCTCCTTCTT |