Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.104962 |
Chromosome: | chromosome 5 |
Location: | 428835 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g232751 | (1 of 2) PTHR23518:SF2 - MULTIDRUG RESISTANCE PROTEIN MDTH | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCGACCCGCTAGTTGCATTCGCACACAC |
Internal bar code: | AACCTCAGTCGGACCACTGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 237 |
LEAP-Seq percent confirming: | 4.0116 |
LEAP-Seq n confirming: | 498 |
LEAP-Seq n nonconfirming: | 11916 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTACTGCCACTGCTACTG |
Suggested primer 2: | TCATCACCATCCTCTCTCCC |