| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.105384 |
| Chromosome: | chromosome 12 |
| Location: | 6549414 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g539100 | HEL57 | (1 of 1) K14811 - ATP-dependent RNA helicase DBP3 [EC:3.6.4.13] (DBP3); DEAD box RNA helicase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCATCGTCAAGTCGCTGTACGACGAGCA |
| Internal bar code: | TTCTCTGTCGATCTGCGCGCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1051 |
| LEAP-Seq percent confirming: | 97.987 |
| LEAP-Seq n confirming: | 10076 |
| LEAP-Seq n nonconfirming: | 207 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGCGGATGTTACAGAGGG |
| Suggested primer 2: | GATGGTCAGTCTGATGGCCT |