| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.105934 |
| Chromosome: | chromosome 7 |
| Location: | 6185942 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g356250 | CYP741A1,CYP23 | (1 of 1) 1.14.13.173 - 11-oxo-beta-amyrin 30-oxidase / CYP72A154; Cytochrome P450, CYP197 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGAAACGGACGATGAACTCTGCGGGATA |
| Internal bar code: | GACTATCAAATTGGCGTATCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 237 |
| LEAP-Seq percent confirming: | 99.5652 |
| LEAP-Seq n confirming: | 687 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACGTGACGCCAGAGTAGG |
| Suggested primer 2: | GTGCAAAGTGCACAGAAGGA |