| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.106894 |
| Chromosome: | chromosome_9 |
| Location: | 1193424 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre09.g399911 | CDC20 | Activator and specificity subunit of anaphase promoting complex | sense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | CATCGCGCTTTCGTACGTCCCTGGACCTGC |
| Internal bar code: | CGTCAGTCGTTTCTCAACTCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 581 |
| LEAP-Seq percent confirming: | 40.9182 |
| LEAP-Seq n confirming: | 820 |
| LEAP-Seq n nonconfirming: | 1184 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTACCTGGAGGGTGAAAGG |
| Suggested primer 2: | CCGTGTGTGTGTGTGTGTGT |