| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.107351 |
| Chromosome: | chromosome 10 |
| Location: | 2910879 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440200 | SMC5B | (1 of 2) PTHR19306:SF1 - STRUCTURAL MAINTENANCE OF CHROMOSOMES PROTEIN 5; Structural Maintenance of Chromosomes protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAAGGAGATCGGCTGTGCGGGCGAGGTG |
| Internal bar code: | GCAGGGGCATCTCAGGGTCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 715 |
| LEAP-Seq percent confirming: | 99.5945 |
| LEAP-Seq n confirming: | 2947 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATGCCCAATCACTTCACA |
| Suggested primer 2: | CCGTGTTAGTCCTGATGGCT |