| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.108243 |
| Chromosome: | chromosome 3 |
| Location: | 8970116 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g209281 | (1 of 1) IPR000547//IPR001680//IPR011990//IPR015943//IPR017986 - Clathrin, heavy chain/VPS, 7-fold repeat // WD40 repeat // Tetratricopeptide-like helical domain // WD40/YVTN repeat-like-containing domain // WD40-repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGACATCCCTGTACCCAGGCGCTGTGCT |
| Internal bar code: | TCGCAGAATGCAAATTTCCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 259 |
| LEAP-Seq percent confirming: | 95.5303 |
| LEAP-Seq n confirming: | 13294 |
| LEAP-Seq n nonconfirming: | 622 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCAGACGTCCATCACCTG |
| Suggested primer 2: | TCCACGACACGTAGAGATGC |