Insertion junction: LMJ.RY0402.108987_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.108987
Chromosome:chromosome_1
Location:7070921
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre01.g051050 FAP225 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GGCCTGCATGAGACCGACGCTGCCAGTGGC
Internal bar code:ATGTCGGTCAAGTTCTTGCGCT

Confirmation - LEAP-Seq

LEAP-Seq distance:748
LEAP-Seq percent confirming:99.6844
LEAP-Seq n confirming:12002
LEAP-Seq n nonconfirming:38
LEAP-Seq n unique pos:14

Suggested primers for confirmation by PCR

Suggested primer 1:CGCATACTGCGCGATAACTA
Suggested primer 2:AAGGACAGCACGGAGAAGAA