| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.109136 |
| Chromosome: | chromosome 6 |
| Location: | 5566784 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g285401 | HLP1,FAP355 | Histone-like Flagellar Associated protein; (1 of 1) PF00216 - Bacterial DNA-binding protein (Bac_DNA_binding) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAGGCGAATATTACCTGGGCTGCGTCTA |
| Internal bar code: | CTTGCTTGACAACGCCCTTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 59 |
| LEAP-Seq percent confirming: | 12.963 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACATTGGCAACAAGTCA |
| Suggested primer 2: | TCAGCAACCAAAAGGAGGAC |