| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.109198 |
| Chromosome: | chromosome 2 |
| Location: | 1226237 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g082300 | SUR6 | (1 of 1) PF04935 - Surfeit locus protein 6 (SURF6); Surfeit 6-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTTGTGGTGTGCTAGGCCAAGTGCCACA |
| Internal bar code: | TATATTGGCGAAGGCGCTTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 558 |
| LEAP-Seq percent confirming: | 98.7528 |
| LEAP-Seq n confirming: | 2217 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCAGGATTGACGGTTGCTC |
| Suggested primer 2: | GAATCCCCACGGATATGATG |