Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.109721 |
Chromosome: | chromosome 5 |
Location: | 1212405 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g245351 | (1 of 1) PF00059//PF00530//PF00704//PF14295 - Lectin C-type domain (Lectin_C) // Scavenger receptor cysteine-rich domain (SRCR) // Glycosyl hydrolases family 18 (Glyco_hydro_18) // PAN domain (PAN_4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTTTCGCACCCCTTACACACACACACAC |
Internal bar code: | AAACTTCTAGCCCCTCCCCCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 508 |
LEAP-Seq percent confirming: | 99.5994 |
LEAP-Seq n confirming: | 10443 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGGTTGATAGTGTCCCAGT |
Suggested primer 2: | TTGACACAAACACAGCCCAT |