Insertion junction: LMJ.RY0402.111243_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.111243
Chromosome:chromosome_6
Location:5354058
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g283500 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):TTAAGATACCCGCTCACTGCCACGGGCGCA
Internal bar code:TCCGTGTTAGGGGGTCACGGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:584
LEAP-Seq percent confirming:98.6812
LEAP-Seq n confirming:2170
LEAP-Seq n nonconfirming:29
LEAP-Seq n unique pos:26

Suggested primers for confirmation by PCR

Suggested primer 1:GACGACGAGAAGACCGAAAG
Suggested primer 2:GTTTTGAGCAGCATCTGTCG