| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.111652 |
| Chromosome: | chromosome 6 |
| Location: | 5139771 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281250 | CFA1 | Cyclopropane fatty acid synthase; (1 of 1) 2.1.1.79 - Cyclopropane-fatty-acyl-phospholipid synthase / Unsaturated-phospholipid methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTTGAATTACAGTGCGCACGACCCTTG |
| Internal bar code: | GTTTATCTCGCCCATGGTGGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 575 |
| LEAP-Seq percent confirming: | 99.8219 |
| LEAP-Seq n confirming: | 11768 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGTTCCAGACTTTCATCA |
| Suggested primer 2: | GGGCAGTTTCATACTCGCAT |