| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.112571 |
| Chromosome: | chromosome 8 |
| Location: | 549392 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g359350 | CMP2,BC1, CARB1 | (1 of 1) K01961 - acetyl-CoA carboxylase, biotin carboxylase subunit (accC); Biotin carboxylase (ACCase complex) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACAGATCAACGCACACGACGCAAGATGG |
| Internal bar code: | TCGACAACGACCGGGCGAGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 505 |
| LEAP-Seq percent confirming: | 99.8419 |
| LEAP-Seq n confirming: | 1263 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTCTTACAGTTGCCTGCG |
| Suggested primer 2: | GCGACGTGAGTGAAAAGACA |