| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.113831 |
| Chromosome: | chromosome 10 |
| Location: | 6562584 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g467200 | ATR1 | (1 of 2) PTHR11139:SF69 - SERINE/THREONINE-PROTEIN KINASE ATR; ATM/ATR-related phosphatidylinositol 3-kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCTCTCCTCTGTAAACACATCGATCACG |
| Internal bar code: | ATCTACCGTCCTGATGCCTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 727 |
| LEAP-Seq percent confirming: | 99.7596 |
| LEAP-Seq n confirming: | 830 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTGCGCATTGCTATTTA |
| Suggested primer 2: | ATGTCCAACTCCCACTGGTC |