| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.114060 |
| Chromosome: | chromosome 16 |
| Location: | 1215330 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g650900 | (1 of 1) IPR000104//IPR001965//IPR011011//IPR017956 - Antifreeze protein, type I // Zinc finger, PHD-type // Zinc finger, FYVE/PHD-type // AT hook, DNA-binding motif | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACAGCCCGCCGCCCAGAACTGCGGACG |
| Internal bar code: | TGCAGAAGGACTGGGATCGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 125 |
| LEAP-Seq percent confirming: | 99.9082 |
| LEAP-Seq n confirming: | 1088 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGAGTGCTTGCAACATGCC |
| Suggested primer 2: | GTGCTACCGTGTTGGAAGGT |