Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.114155 |
Chromosome: | chromosome 3 |
Location: | 3048867 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g164250 | FAP262 | (1 of 1) PF00612//PF07714 - IQ calmodulin-binding motif (IQ) // Protein tyrosine kinase (Pkinase_Tyr); Flagellar Associated Protein 262, protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGAGGAGGGAGGAGAAAGGGGGGGGGGC |
Internal bar code: | GCACGCATGATGCCGGATTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 890 |
LEAP-Seq percent confirming: | 99.7074 |
LEAP-Seq n confirming: | 1704 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGAAAATGGTGTACCGCGAC |
Suggested primer 2: | CTCCTCCGCTTCTGCTACCT |