Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.114947 |
Chromosome: | chromosome 6 |
Location: | 1922143 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g263550 | LCI7,SELU1 | SELU homolog; (1 of 1) PTHR28630//PTHR28630:SF3 - FAMILY NOT NAMED // REDOX-REGULATORY PROTEIN FAM213A | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAGGGAGGCGGATGAAGAGGGCGGGTT |
Internal bar code: | ACGTAAGCCGTGCCTGTAGAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 547 |
LEAP-Seq percent confirming: | 99.3103 |
LEAP-Seq n confirming: | 144 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATACATGCAACGCAACCAAA |
Suggested primer 2: | GCTCCGCTTATCACACATCA |