| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.116303 |
| Chromosome: | chromosome 13 |
| Location: | 2301063 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g579050 | APC1 | (1 of 4) IPR002020 - Citrate synthase; Chlamydomonas specific family protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTTTTGGGATGGCCCTTAACGCCCCGT |
| Internal bar code: | AAGGTGAGTCAGACAGCGTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 887 |
| LEAP-Seq percent confirming: | 99.8103 |
| LEAP-Seq n confirming: | 5262 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCATGTATGCAGGAGGACA |
| Suggested primer 2: | CATAGGAGCTTCGCTTGACC |