| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.116663 |
| Chromosome: | chromosome 2 |
| Location: | 3994377 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g096900 | TIE1 | (1 of 2) 4.6.1.16 - tRNA-intron lyase / tRNA splicing endonuclease; tRNA-intron endonuclease | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCTCTCTTGCGCCTCCTGCTTGCTCC |
| Internal bar code: | CTTTCAGGGGGGGGTAAGGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 589 |
| LEAP-Seq percent confirming: | 99.6132 |
| LEAP-Seq n confirming: | 3348 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTGATGATGGGTGGTGGT |
| Suggested primer 2: | GGTGAAGAAGCTCATCCTGC |