Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.116703 |
Chromosome: | chromosome 10 |
Location: | 4466438 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g451600 | SRR28,SRR28B | (1 of 1) PF00059//PF00704//PF14295 - Lectin C-type domain (Lectin_C) // Glycosyl hydrolases family 18 (Glyco_hydro_18) // PAN domain (PAN_4); Lectin-domain glycosyl hydrolase | intron|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGATTTCGTGTGGAAGAGTCGGGTTTGATC |
Internal bar code: | AGGTTTCTCTCCCGATCCGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1203 |
LEAP-Seq percent confirming: | 99.6934 |
LEAP-Seq n confirming: | 2276 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTCAATGGGTCACAGTGC |
Suggested primer 2: | GGAGTCCCAGTGGAAGTTGA |