| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.117676 |
| Chromosome: | chromosome 6 |
| Location: | 5003696 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280050 | ROC86,XRN1 | (1 of 1) K12618 - 5'-3' exoribonuclease 1 (XRN1, SEP1, KEM1); 5' to 3' exoribonuclease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGTGTGCCGGCGCAGACGTGTAACAGTC |
| Internal bar code: | TCAGGGCCACGTGACGAGCACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1006 |
| LEAP-Seq percent confirming: | 99.9015 |
| LEAP-Seq n confirming: | 2028 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGATCCTAGAGCCTGAGTG |
| Suggested primer 2: | AACTTGGTGAGGAATGTGGC |