Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.118064 |
Chromosome: | chromosome 14 |
Location: | 523885 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g611450 | PLP7,PLAP7 | Plastid lipid associated protein 7; (1 of 17) PF04755 - PAP_fibrillin (PAP_fibrillin) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCAGCGAGCATAGCTGACACCGACTGC |
Internal bar code: | GAGCCGTGAGGAACGGACATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 749 |
LEAP-Seq percent confirming: | 99.9011 |
LEAP-Seq n confirming: | 1010 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTACGCGTGTTAAAGAGCA |
Suggested primer 2: | GCTCGGTGTATGACTCAGCA |