| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.118345 |
| Chromosome: | chromosome 1 |
| Location: | 4476698 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g030500 | CYG58 | (1 of 1) K11858 - ubiquitin carboxyl-terminal hydrolase 48 [EC:3.4.19.12] (USP48); Adenylate/guanylate cyclase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTCCAGCGTTGGCAATGGTACCTGGAGT |
| Internal bar code: | GGCGACGTGGGCAATTCGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 715 |
| LEAP-Seq percent confirming: | 99.2132 |
| LEAP-Seq n confirming: | 3657 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCTCAGGTAGTTGCGGAC |
| Suggested primer 2: | GTGGATGTCCTTGGCGTAGT |