| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.119149 |
| Chromosome: | chromosome 13 |
| Location: | 1311726 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g571200 | HKR5,HIK5,HIK | (1 of 1) IPR000014//IPR001789//IPR003594//IPR003661//IPR004358//IPR005467//IPR011006 - PAS domain // Signal transduction response regulator, receiver domain // Histidine kinase-like ATPase, C-terminal domain // Signal transduction histidine kinase, dimerisation/phosphoacceptor domain // Signal transduction histidine kinase-related protein, C-terminal // Histidine kinase domain // CheY-like superfamily; Histidine kinase response regulator of two-component system | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGACACGTGTGTACACATGTTCGTCCTT |
| Internal bar code: | CGTACTCATGTGACCAGGTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 850 |
| LEAP-Seq percent confirming: | 99.7127 |
| LEAP-Seq n confirming: | 2777 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTCTAGGGTGGTGAGGT |
| Suggested primer 2: | GGCGTGGCTCTAGTGAGAAC |